GotAI.NET

Форум: Проблемы искусственного интеллекта

 

Регистрация | Вход

 Все темы | Новая тема Стр.44 (140)<< < Пред. | След. > >>   Поиск:  
 Автор Тема: На: Пример корректной аргументации
Dark Welder
Сообщений: 1155
На: Пример корректной аргументации
Добавлено: 24 янв 11 10:56
Цитата:
Автор: Андрей
стрекоза

Ископаемая стрекоза ОДНА. Современных стрекоз ДВЕ разных. Что доказывает данная фотография:
-из одного вида стрекоз в результате эволюции получилось два? Или даже все 4500 современных?
-божественное двуединство стрекоз?
-Харуну Яхье все равно, что на фотографиях изображено?
-какое-то другое объяснение того, как один вид стрекоз, не меняясь, превращается в два?

P.S.Но это все лирика. Все эти фотки просто не нужны, потому что они не противоречат теории эволюции
[Ответ][Цитата]
Андрей
Сообщений: 3816
На: Пример корректной аргументации
Добавлено: 24 янв 11 12:10
Цитата:
Автор: Чарльз Дарвин "Происхождение видов", Глава X. О неполноте геологической летописи

"В VI главе я перечислил главные возражения, которые вполне основательно могли бы быть сделаны против защищаемых в этой книге взглядов. Большинство их нами уже рассмотрено. Одно из них представляет совершенно очевидную трудность для этих взглядов, а именно: обособленность видовых форм и отсутствие между ними бесчисленных связующих звеньев.
Цитата:
Автор: Stephen Jay Gould, "Evolution's Erratic Pace," Natural History, Vol. 5, May 1977, p. 14.

"The extreme rarity of transitional forms in the fossil record persists as the trade secret of paleontology. The evolutionary trees that adorn our textbooks have data only at the tips and nodes of their branches; the rest is inference, however reasonable, not the evidence of fossils... We fancy ourselves as the only true students of life's history, yet to preserve our favored account of evolution by natural selection we view our data as so bad that we never see the very process we profess to study"
Собственно из-за этого всего и были вынуждены эволюционисты пойти на компромисс со своей догмой и родить теорию прерывистого равновесия. Подвергать сомнению факт неизменности видов на протяжени миллионов лет или факт отсутствия перходных форм, значит отрицать те факты, на которых стоит сегодня сам ортодоксальный эволюционизм.
[Ответ][Цитата]
NO.
Сообщений: 10700
На: Пример корректной аргументации
Добавлено: 24 янв 11 14:18
[Ответ][Цитата]
Вольфрамовый клапан
Сообщений: 809
На: Пример корректной аргументации
Добавлено: 24 янв 11 16:16
Цитата:
Рэфф Р., Кофмен Т. Эмбрионы, гены и эволюция - М.: Мир, 1986

Рис. 2-7. Кривые выживания родов вымерших двустворчатых моллюсков (●) и хищных млекопитающих (○). Выживание выражено в процентах родов, просуществовавших в течение указанных по оси абсцисс периодов времени (Simpson, 1953).

Вымирание видов происходит чисто статистически по экспоненциальному закону. Период полувымирания семейств для беспозвоночных составляет примерно 50 млн. лет. Т.е. с вероятностью 0.1% семейство беспозвоночных может просуществовать 500 млн. лет. Что мы и фактически наблюдаем. Семейства, сохранившиеся со времён кембрийского периода, единичны.

По такому же закону распадаются радиоактивные изотопы, ломаются телевизоры и прочая электроника.
[Ответ][Цитата]
Вольфрамовый клапан
Сообщений: 809
Промежуточные звенья существуют
Добавлено: 24 янв 11 18:26
Цитата:
Автор: Stephen Jay Gould, "Evolution's Erratic Pace," Natural History, Vol. 5, May 1977, p. 14.
"The extreme rarity of transitional forms in the fossil record persists as the trade secret of paleontology…

Я довольно скверно знаю английский, поэтому прошу компетентных товарищей разъяснить. Выделенная фраза переводится как «абсолютное отсутствие переходных форм» или «чрезвычайная редкость переходных форм»? Я всё-таки склоняюсь ко второму варианту. Потому что через 4 года после указанной статьи Гулд написал буквально следующее:
Цитата:
Автор: Stephen Jay Gould, "Evolution as Fact and Theory," Discover 2 (May 1981): 34-37

http://www.stephenjaygould.org/library/gould_fact-and-theory.html

The third argument is more direct: transitions are often found in the fossil record. Preserved transitions are not common—and should not be, according to our understanding of evolution (see next section) but they are not entirely wanting, as creationists often claim. The lower jaw of reptiles contains several bones, that of mammals only one. The non-mammalian jawbones are reduced, step by step, in mammalian ancestors until they become tiny nubbins located at the back of the jaw. The "hammer" and "anvil" bones of the mammalian ear are descendants of these nubbins. How could such a transition be accomplished? the creationists ask. Surely a bone is either entirely in the jaw or in the ear. Yet paleontologists have discovered two transitional lineages of therapsids (the so-called mammal-like reptiles) with a double jaw joint—one composed of the old quadrate and articular bones (soon to become the hammer and anvil), the other of the squamosal and dentary bones (as in modern mammals).

For that matter, what better transitional form could we expect to find than the oldest human, Australopithecus afarensis, with its apelike palate, its human upright stance, and a cranial capacity larger than any ape’s of the same body size but a full 1,000 cubic centimeters below ours? If God made each of the half-dozen human species discovered in ancient rocks, why did he create in an unbroken temporal sequence of progressively more modern features—increasing cranial capacity, reduced face and teeth, larger body size? Did he create to mimic evolution and test our faith thereby?

Краткий пересказ написанного:
в ухе млекопитающих есть т.н. слуховые косточки («молоточек» и «наковаленка»), которые передают колебания звука от барабанной перепонки к «улитке», где расположены слуховые нервы. Эти косточки произошли из костей составной челюсти терапсид (рептилий, предков млекопитающих). Непрерывная трансформация костей челюсти терапсид в слуховые косточки млекопитающих хорошо документирована в окаменелостях.

Эта же трансформация происходит в эмбриональном развитии млекопитающих.

Вот сравнение строения уха рептилии и млекопитающего (здесь же отмечена третья слуховая косточка - «стремечко»).


А вот как происходила трансформация по палеонтологическим данным:



Во второй части цитаты Гулд рассказывает о хорошо документированной в палеонтологических находках трансформации из австралопитека в человека (череп А – шимпанзе, B – австралопитек африканский, …, N - человек).



Картинки отсюда: http://www.talkorigins.org/faqs/comdesc/section1.html
[Ответ][Цитата]
Андрей
Сообщений: 3816
На: Промежуточные звенья
Добавлено: 24 янв 11 19:24
Цитата:
Автор: Stephen Jay Gould, "An Asteroid to Die For," Discover, October 1989, p. 65

"The Precambrian record is now sufficiently good that the old rationale about undiscovered sequences of smoothly transitional forms will no longer wash."
Цитата:
Автор: David E. Schindel, "The Gaps in the Fossil Record," Nature, Vol. 297, 27 May 1982, p. 282.

"...the gradual morphological transitions between presumed ancestors and descendants, anticipated by most biologists, are missing."
Я полагаю, эволюционистам не стоит пытаться копать в сторону палеонтологии в поисках доказательств эволюции, это явно их самая слабая сторона... Причём это признают даже самые заядлые эволюционисты.
Косточки в ушах - это замечательно, только у соответствующих видов мы находим их в сформированном и полностью функциональном состоянии. И речь ведь идёт не о гомологичных органах, а о промежуточных видах!

Ваша тактика стала предсказуемой - общие правила Вы "опровергаете" редкими исключениями из этих правил, искусственно раздувая их до размеров "доказательств". Ваши посты на несколько листов не перевешивают нескольких строк мелкого текста. Здесь надо не картинками впечатлять, а аргументировать. Хотя чем Вам аргументировать...
Мне даже возражать ничего Вам не надо, потому что Ваши "контраргументы" опять невпопад. Тупо заваливаете топик всякими трилобитами и пропагандой, вместо красноречивого но честного молчания.

Не обижайтесь, но мне Ваше поведение напоминает повадки старой раздолбанной продажной женщины, которая всю свою жизнь прожгла на случайных мужиков, и теперь, чтобы доказать себе, что она не дура, пытается молоденьких девочек склонить к тому же способу жизни, который когда-то выбрала она сама, убеждая их, что семья и дети - это фигня, а вот бабки и мужики - это самый смак.
[Ответ][Цитата]
Вольфрамовый клапан
Сообщений: 809
На: Промежуточные звенья
Добавлено: 25 янв 11 6:05
Цитата:
Автор: Андрей
Я полагаю, эволюционистам не стоит пытаться копать в сторону палеонтологии в поисках доказательств эволюции, это явно их самая слабая сторона... Причём это признают даже самые заядлые эволюционисты.

Жизнь такова, какова она есть, и больше никакова. Если палеонтологических находок с промежуточными формами мало, то не стоит, конечно, делать вид, что их много, но не стоит делать вид, что их нет вообще. То, что преобразования видов при определённых условиях происходят очень быстро – это тоже наблюдаемый факт. В экстремальных условиях новые виды образуются за несколько десятков поколений. В Аральском море, скажем, на возникновение новых видов ушло порядка 20 лет. Среднее же время жизни биологического вида исчисляется миллионами лет. Так что вероятность найти в земле сохранившееся «переходное звено» примерно равно отношению этих чисел.

Если бы Гулд, как вы мечтаете, объявил, что эволюции не существует, он бы погрешил против истины, потому что примеры трансформаций найдены, несмотря на их малую вероятность. Так что теория прерывистого равновесия вполне логична, не знаю уж, чем она вам не нравится.

Ваши попытки делать вид, что исключения ничего не значат и даже подтверждают правило выглядят комично. Исключения – это как раз те самые штуки, которые хоронят правила. Айсберг, который похоронил «Титаник», тоже был исключением.

Что касается ваших ассоциаций с проститутками, то ассоциации у каждого соответствуют жизненному опыту. Мне в кругах раздолбанных проституток вращаться не приходилось, так что вам виднее
[Ответ][Цитата]
Андрей
Сообщений: 3816
На: Промежуточные звенья
Добавлено: 25 янв 11 11:39
Цитата:
Автор: Вольфрамовый клапан
Если бы Гулд, как вы мечтаете, объявил, что эволюции не существует, он бы погрешил против истины
Если бы Гулд сказал прямо, как есть - что нету никаких ископаемых переходных видов, его бы уволили с работы... Он и так много "проговорился".

Цитата:
Автор: Вольфрамовый клапан
Айсберг, который похоронил «Титаник», тоже был исключением
Ваш ум (в этом топике во всяком случае) перестроился на раздувание ничтожных мелочей и на преуменьшение подавляющего большинства фактов. Для веры - это нормальный подход, я сам бы так делал. Но для подтверждения "фундаментальной научной теории" - извините...

Я вот щас "докажу" Вашим методом, что полный стакан воды на самом деле пустой.
В стакане содержится всего лишь 0,0000000002 Мт воды. За секунду с её поверхности улетает примерно 2.580.000.000.000.000.000 молекул. Можно сказать, что вода бурным потоком выплёскивается через край, сама выпрыгивает из стакана и стакан, в принципе, в таких условиях не может быть полным. Таким образом он перманентно пуст. Опа!

Вот такие умники как Вы и "доказывают", что эволюция существует. Как хорошо, что мне удалось выскочить из этого зомбятника.
[Ответ][Цитата]
NO.
Сообщений: 10700
На: Промежуточные звенья
Добавлено: 11 фев 11 4:28
книжка по-английски, Умные алгоритмы в природе, там есть все варианты эволюции
http://www.lulu.com/product/file-download/clever-algorithms-nature-inspired-programming-recipes/14696557
[Ответ][Цитата]
Андрей
Сообщений: 3816
На: Доказательства биологической эволюции
Добавлено: 11 фев 11 14:07
Изменено: 25 янв 15 4:12
Любопытная книжка, даёт конкретные примеры того, к чему порой аппелируют голословно. Но к той эволюции, которая здесь обсуждается, книга не имеет никакого отношения.
1. Все эти алгоритмы - честный пример креационизма.
2. Все случайные мутации в этих алгоритмах - потенциально полезные ("физиологически" не вредные).
3. Критерий качества получаемых решений заложен в алгоритм извне. Нет того гипотетического тестирования организмов путём непосредственного выживания, в которое верят эволюционисты. Алгоритмы не призваны верифицировать ключевые принципы биологической эволюции путём моделирования оной, они призваны решить конкретную математическую проблему. Фактически это программирование не естественного отбора, а селекции.
4. Гипотетические механизмы эволюции были взяты только в качестве аналогии, никаких решений конкретных проблем эволюции эти алгоритмы не демонстрируют (например, решения конкретной проблемы изменения кариотипа или палеонтологических проблем).
5. Алгоритмы работают не потому, что они эволюционные (что, якобы, доказывает эволюцию), а потому что эти алгоритмы основаны на переборе - универсальном методе интеллекта. Который существовал до эволюционных выдумок, и который будет существовать после.

Эволюционные алгоритмы делают медвежью услугу для биологов-эволюционистов, потому что они показывают, как на самом деле может работать эволюция - ортогенез, неоламаркизм. Но только эти направления - вычурные перефразировки креационизма, поэтому они также "забанены" в ортодоксальной науке.

Поскольку опять подняли со дна форума этот топик, приведу ещё пару проблем эволюции.

1. Этологическая проблема.

http://ru.wikipedia.org/wiki/Сент-Дьёрди,_Альберт -> Альберт Сент-Дьёрди, нобелевский лауреат по физиологии и медицине, пишет:
Цитата:
Автор: Альберт Сент-Дьёрди

"Herring gulls" have a red patch on their beak. This red patch has an important meaning, for the gull-feeds its babies by going out fishing and swallowing the fish it has caught. Then, on coming home, the hungry baby gull knocks at the red spot. This elicits a reflex of regurgitation in mama, and the baby takes the fish from her gullet. All this may sound very simple, but it involves a whole series of most complicated chain reactions with a horribly complex underlying nervous mechanism of the knocking baby and that of the regurgitating mother. All this had to be developed simultaneously, which, is a random mutation, has the probability of zero. I am unable to approach this problem without supposing an innate 'drive' in living matter to perfect itself"

"У Серебристых чаек есть красное пятно на клюве. Это красное пятно имеет важное значение для кормления птенцов рыбой, которая была поймана и проглочена. Когда чайка возвращается в гнездо, голодный птенец клюёт это красное пятно. Это вызывает рефлекс срыгивания у матери, после чего птенец достаёт рыбу из её глотки. Этот процесс может показаться очень простым, но он включает в себя целую серию сложнейших цепных реакций с чудовищно сложными фундаментальными нервными механизмами клюющего птенца и реагирующей матери. Всё это должно быть развито одновременно, вероятность чего, при случайных мутациях, равна нулю. Я не могу подойти к этой проблеме без предположения некоего врождённого "двигателя" живой материи, позволяющего ей совершенствоваться."
Эта цитата - только один из миллионов примеров поразительного синхронизма различных поведенческих и физиологических аспектов жизни животных. Брачные танцы, инстинкты, системы органов работающих слаженно (например, система свёртывания крови) - свидетельствуют против случайного возникновения живых систем.

2. Проблема молекулярных часов.

Приведу цитату из книги "Ученые креационисты отвечают своим критикам":
Цитата:
Автор: Гиш Дуэйн

"[...]степень мутаций измеряется в количестве мутации на один ген на одно поколение, и наблюдаемый показатель примерно одинаков для многих генов. Для более высоко организованных существ степень мутации равна приблизительно 106 на ген в поколение. Другими словами, каждый ген в одной особи из миллиона в каждом поколении подвергается какой-то мутации — в лучшую сторону, в худшую или нейтральной. В таких видах, как человек и шимпанзе, длительность жизни которых не намного отличается, следовало бы ожидать похожих темпов мутации. А у мышей, напротив, за год сменяются 4 — 5 поколений. Слон достигает половой зрелости в 14 лет; его период беременности равен 18 — 21 месяцам. Получается, что темп смены поколений у мыши в 100 раз выше, чем у слона, но белок мыши так же отличается (в процентах) от белка, скажем, карпа (или любого другого «низшего» существа), как и белок слона.

Еще более резко отличаются сроки смены поколений у насекомых. Фруктовая муха производит на свет потомство за 2 недели, а цикаде для воспроизведения нового поколения требуется 17 лет. Таким образом, темп смены поколений фруктовой мухи в 1000 раз выше, чем у цикады. Если, как верят эволюционисты, современные порядки насекомых возникли около 50 млн. лет назад, за это время сменило друг друга в 50 миллиардов раз больше поколений фруктовой мухи, чем поколений цикады, но белки всех порядков насекомых, включая фруктовую муху и цикаду, одинаково отличаются от белков беспозвоночных, бактерий, растений, грибов и т.д. Если же рассмотреть такие организмы, как деревья и бактерии, разница в сроках смены поколений возрастет до 10.000 раз.

Каким чудом акула, сотни миллионов лет подвергаясь мутациям, все же осталась акулой, а какие-то другие рыбы тем временем превратились сперва в амфибий, потом в рептилий, потом в млекопитающих и, наконец, в человека? Если считается, что темп мутаций у всех животных одинаков (именно на этом основана идея о молекулярных часах), а степень мутации измеряется в количестве мутаций на ген на поколение, то почему белки организмов с огромнейшим разрывом в темпах смены поколений все-таки в равной мере отличаются от предполагаемых предков?

Как вычислили эволюционисты, скорость мутаций гистона составляет 1% в 600 млн. лет, а гемоглобина — 1% в 5,8 млн. лет — более, чем 100-кратная разница. Почему все виды гемоглобина во всех различных филогенетических линиях, будь то муха, улитка, лягушка, тунец, канарейка, корова, крокодил или человек, развиваются ровно в 100 раз быстрее, чем все виды гистона и тоже во всех филогенетических линиях? Если кто-нибудь сможет составить схему для «объяснения» этой загадки, ему придется составлять и другие схемы для объяснения систематических различий темпов мутаций цитохрома С и гемоглобинов, гемоглобинов и миоглобинов, гемоглобинов и разных протеаз, ad infinitum. Как могли естественные процессы, включающие случайные генетические ошибки, предположительно зависящие от условий окружающей среды, таких различных в разных частях света и по-разному действующих на столь многообразные организмы, привести к равномерным темпам мутаций гемоглобина во всех живых существах, и другой, но не менее равномерной скорости мутации цитохрома С во всех существах?"
Фред Хойл в своей книге "Mathematics of Evolution" произвёл расчёты по некоторым эволюционным идеям, говорят убедительно посчитал. Так что от эволюции не осталось и следа. Книжку пока не нашёл, может кто поделится?
Кроме того, нашёл параллельную аналогичную дискуссию по поводу эволюции на форуме iXBT. Такие длительные дискуссии всегда характерны для споров, предметом которых является вера

3. Кубомедуза Tripedalia cystophora обладает органом зрения, подобным человеческому глазу. Занятное "решение эволюции"...

Ну и напоследок, для любителей порассуждать "о птичках" "на голом месте" подбирая аргументы "с потолка", приведу буквальную нуклеотидную последовательность всего 1% 2-ой хромосомы человека, что составляет примерно 0,08% всего генома человека. Чтобы впредь, повторяя мантру: "случайная мутация создала", у людей в голове был хоть примерный масштаб того бедствия, о котором они так смело фантазируют.

2-ая хромосома интересна тем, что представляет собой две соединённые половинки хромосомы 2а и 2b человекообразных обезъян. Эволюционисты сразу повесили на этот факт свой привычный ярлык "доказательство эволюции", но если посмотреть внимательнее, то "доказательство" оборачивается вопросами:
1. Как размножился мутант со слипшимися хромосомами, если хромосомные транслокации людей приводят к уродству?
2. Откуда у человека взялось примерно 150.000 дополнительных нуклеотидов, которых нет ни в одной из половинок хромосом обезъян?
3. Где именно находится та "рудиментарная центромера", о которой пишут статьи? Я так и не смог её разглядеть. И даже если она есть, как она "рудиментировалась"?
А здесь занятная статья по поводу сравнения геномов шимпанзе и человека.

Посмотреть детально все хромосомы человека и других животных можно здесь. А вот, собственно, и само начало 2-ой хромосомы человека:

ЗДЕСЬ
[Ответ][Цитата]
Dark Welder
Сообщений: 1155
На: Пример корректной аргументации
Добавлено: 11 фев 11 14:59
Цитата:
Автор: Гиш Дуэйн
Еще более резко отличаются сроки смены поколений у насекомых. Фруктовая муха производит на свет потомство за 2 недели, а цикаде для воспроизведения нового поколения требуется 17 лет. Таким образом, темп смены поколений фруктовой мухи в 1000 раз выше, чем у цикады. Если, как верят эволюционисты, современные порядки насекомых возникли около 50 млн. лет назад, за это время сменило друг друга в 50 миллиардов раз больше поколений фруктовой мухи, чем поколений цикады, но белки всех порядков насекомых, включая фруктовую муху и цикаду, одинаково отличаются от белков беспозвоночных, бактерий, растений, грибов и т.д.

Чувак явно шарит в арифметике.

P.S.Пересчитайте. Это ЖЕСТЬ.
[Ответ][Цитата]
Mad_God
Сообщений: 545
На: Пример корректной аргументации
Добавлено: 11 фев 11 16:31
Подозреваю, что перевод чуть более чем полностью.
[Ответ][Цитата]
NO.
Сообщений: 10700
На: Пример корректной аргументации
Добавлено: 11 фев 11 21:15
Миллионы! Миллиарды насекомых!
[Ответ][Цитата]
Aleksandr1
Сообщений: 2781
На: Пример корректной аргументации
Добавлено: 12 фев 11 14:29
При попытках физического описания возникновения живых существ из неживой материи возникают трудности, связанные с оценками маловероятных событий. Показано, что эти трудности — результат предвзятого понимания слова «кодирует». Они снимаются, если принять, что в первичных организмах (гиперциклах) полинуклеотид не «кодировал», а катализировал образование белка. Рассмотрен реалистический сценарий такого процесса, включая возникновение единого кода. Обсуждается проблема мышления и образование соответствующего аппарата в эволюции. Для этой цели приведен анализ понятий: информация, ценная информация и генерация информации. Показано, что мышление в значительной мере сводится к распознаванию образа. Рассмотрен возможный молекулярный механизм процесса распознавания. Показано, что возникновение подобного механизма в эволюции вполне вероятно.


http://ufn.ru/ru/articles/2000/2/c/


сайт


http://ufn.ru/ufn00/ufn00_2/Russian/r002c.pdf
[Ответ][Цитата]
Андрей
Сообщений: 3816
На: Пример корректной аргументации
Добавлено: 12 фев 11 19:14
Цитата:
Автор: Dark Welder
Чувак явно шарит в арифметике.
В тексте действительно арифметические неточности. К сожалению, я не нашёл оригинала, так что не могу судить, кто ошибся - автор или переводчик. Но так или иначе, смысл проблемы молекулярных часов донесён и ясен без расчётов, так что эта ошибка принципиально ничего не меняет.

Цитата:
Автор: Aleksandr1
Показано, что возникновение подобного механизма в эволюции вполне вероятно
В статье есть ряд любопытных гипотез (мне понравилась аналогия с развитием письменности), но не более того. Авторы делают слишком много принципиальных умозрительных допущений, не подкреплённых никакими фактами.

А пока любители эволюции выискивают доказательства в пользу своей догмы, я колёсиком мышки внимательно пролистал те 0,08% человеческого генома, которые приведены на предыдущей странице обсуждений. Нашёл ряд замечательных регулярностей, которые (ну конечно же!) "доказывают" происхождение человека путём случайных мутаций
Геном буквально нашпигован периодичностями. Ниже привожу ряд выразительных блоков:
(я переместил переносы строк для удобства визуального восприятия регулярностей. Последовательность нуклеотидов в блоках осталась без изменений).

GGAAGGGAGGAAGGTAGGAAGGAAGGGAGGAAGGGAGGGAGGAAGGGA
GGGAGGAAGGGAGGGAGGAAGGGAGGGAGGAAGGGAGGAAGGGAGGGA
GGGAGGAAGGGAGGGAGGAAGGGAGGGAGGAAGGGAGGGAGGGAGGGA
GGAAGGGAGGGAGGGAGGAAGGGAGGGAGGGAGGGAGGGAGGGAGGGA
GGGAGGGAGGGAGGAAGGGAGGGAGGGAGGAAGGGAGGGAGGGAGGGA
GGGAGGGAGGAAGGGAGGAAGGGAGGGAGGAAGGGAGGGAGGAAGGGA
GGAAGGAAGGGAGGAAGGAAGGGAGGGAGGGAGGGAGGGAGGGAGGAA
GGGAGGGAGGGAGGAAGGAAGGGAGGGAGGGAGGAAGGGAGGGAGGAA
GGGAGGGAGGAAGGAAGGGAGGGAGGGAGGAAGGGAGGGAGGAAGGGA
GGGAGGAAAGGAGGGAGGGAGGGAGGGAGGGAGGGAGGAAGGGAGGGA
GGAAGGGAGGAAGGAAGGGAGGAAGGAAGGGAGGGAGGGAGGGAGGGA
GGGAGGAAGGGAGGGAGGGAGGAAGGAAGGGAGGGAGGGAGGAAGGGA
GGGAGGGAGGGAGGGAGGAAGGAAGGGAGGGAGGGAGGAAGGGAGGGA
GGAAGGGAGGGAGGAAAGGAGGGAGGGAGGGAGGGAGGGAGGGAGGAA
GGGAGGGAGGAAGGGAGGAAGGAAGGGAGGGAGGAAGGGAGGGAGGAA
GGGAGGGAGAGAGGGAGGGAGGAAGAAATGAAGGAA

CGCTTTCTCTCTTGAGTCCTCACAGGGGCCCACCTTCCTCACAGATGG
CGCTTTCTCACTGAGTCCTCACGTGGGGCCCGCCTTCCTCATAGATGG
CGCTTTCTCACTGAGTCCTCACACAAGGCCCCCCTTCCTCATAGATGG
CGCTTTCTCACTGAGTCCTCACACGAGGCCCGCCTTCCTCATAGATGG
CGCTTTCTCACTGAGTCCTCACACGAGGCCCACCTTCCTCACAGATGG
CGCTTTCTCACTGAGTCCTCACACGAGGCCCGCCTTCCTCATAGATGG
CGCTTTCTCACTGAGTCCTCACGTGAGGCCCGCCTTCCTCATAGATGG
CGCTTTCTCACTGAGTCCTCACACGAGGCCCACCTTCCTCACAGATGG
CGCTTTCTCACTGAGTCCTCACGTGGGGCCCGCCTTCCTCATAGATGG
CGCTTTCTCACTGAGTCCTCACACAAGGCCCGCCTTCCTCATAGATGG
CGCTTTCTCACTGAGTCCTCACACGAGGCCCACCTTCCTCACAGATGG
CACTTTCTCACTGAGTCCTCACGTGGGGCCCGCCTTCCTCATAGATGG
CGCTTTCTCACTGAGTCCTCACGTGAGGCCCGCCTTCCTCATAGATGG
CGCTTTCTCACTGAGTCCTCACACGAGGCCCACCTTCCTCACAGATGG
CGCTTTCTCACTGAGTCCTCACGTGGGGCCCGCCTTCCTCATAGATGG
CGCTTTCTCACTGAGTCCTCACACAAGGCCCGCCTTCCTCATAGATGG
CGCTTTCTCACTGAGTCCTCACACGAGGCCCGCCTTCCTCATAGATGG
CACTTTCTCACTGAGTCCTCACGTGGTGGAGGGTGC

CACACAGGTAGCGAGGAGGCCGGGGTGTTAATACA
CACACAGGTAGCGAGGAGGCCGGGGTGTTAATACA
CACACAGGTAGTGAGGAGGCCGGGGCATTAATACA
CACACAGGTAGTGAGGAGGCCGGCGTGTTAATACA
CAGGTAGCGAGGAGGCCGGGGTGTTAATACACACA
CAGGTAGCGAGGAGGCCGGGGTGTTAATACACACA
CAGGCAGCGAGGAGGCCGGGGTGTTAATACACACA
CAGGTAGTGAGGAGGCCGGCGTGTTAATACACACA
CAGGTAGTGAGGAGGCCGGGGCGTTAATACACACA
CAGGTAGCGAGGAGGCCGGGGCGTTAATACACACA
CAGGTAGCGAGGAGGCCGGGGCGTTAATACACACA
CAGGTAGCGAGGAGGCCGGGGCGTTAATACACACA
CAGGTAGCGAGGAGGCCGGGGCGTTAATACACACA
CAGGTAGCGAGGAGGCCGGGGTGTTAATACACACA
CAGGCAGCGAGGAGGCCCGGGTGTCTAATACACAC
ACAGGTAGCGAGGAGGCCGGGGCGTTAATACACAC
ACAGGTAGCGAGGAGGCCGGCGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGCGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAATGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAGCGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGCGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAATGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGCGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGCGTGTTAATACACAC
ACAGGTAGTAAGGAGGTCGGGGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAATGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAGCGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAATGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAGCGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAGCGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAGCGAGGAGGCCGGCGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGCGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAGCGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAGCGAGGAGGCCGGCGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGGGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGCGTGTTAATACACAC
ACAGGTAGTGAGGAGGCCGGGGTGTCTAATACACA
CACAGGTAGCGAGGAGGCCGGGGTGTTAATACACA
CACAGGTAGCGAGGAGGCCGGCGTGTTAATACACA
CACAGGTGAGTGAGGAGGCCGGCGTGTTAATACAC
ACACAGGTAGTGAGGAGGCCGGGGTGTTAATACAC
ACACAGGTAGCGAGGAGGCCGGCGTGTTAATACAC
ACACAGGTAGTGAGGAGGCCGGCGTGTTAATACAC
ACACAGGTAGTGAGGAGGCCGGGGTGTCTAATACA
CACACAGGTAGCGAGGAGGCCGGGGTGTTAATACA
CACACAGGTAGCGAGGAGGCCGGCGTGTTAATACA
CACACAGGTAGTGAGGAGGCCGGGGTGTTAATACA
CACACAGGTAGTGAGGAGGCCGGGGTGTTAATACA
CACACAGGTAGTGAGGAGGCCGGGGTGTTAATACA
CACACAGGTAGTGAGGAGGCCGGGGTGTTAATACA
CACACAGGTAGTGAGGAGGCCGGCGTGTTAATACA
CACACAGGTAGTGAGGAGGCCGGGGTGTCTAATAC
ACACACAGGTAGCGAGGAGGCCGGGGTGTTAATAC
ACACACAGGTAGCGAGGAGGCCGGCGTGTTAATAC
ACACACAGGTAGTGAGGAGGCCGGCGTGTTAATAC
ACACACAGGTAGTGAGGAGGCCGGCGTGTTAATAC
ACACACAGGTAGCGAGGAGGCCGGGGCGTTAATAC
ACACACAGGTAGCGAGGAGGCCGGGATGTTAATAC
ACACACAGGTAGCGAGGAGGCCGGCGTGTTAATAC
ACACACAGGGAGCGAGGAGGCCGGGGTGTTAATAC
ACACACAGGGAGCGAGGAGGCCGGCGTGTTAATAC
ACACACAGGTAGCGAGGAGGCCGGCGTGTTAATAC
ACACACAGGTAGCGAGGAGGTCGGGGTGTCTGCTG

GTGTGCTCAAACTTCACGGCGGGGTGAGGGTGCAGGCATGTGCTTACC
ACACACTCAAACCTCACGGCAGGCTGAGGATGCAGGCATGTGCTTACC
ACACACTCAAACCTCACAGGCAGGCTGAGGGTGCAGGCAGGTGCTTAC
CACACACTCAAACCTCAGGGCGGGCTGAGGATGCAGGCACGTGCTTAC
CAGGCATTCAAACTTCACGACTGGCTGAGGATGCAGGCAGGTGCTTAC
TACACACTCAAACTTCACGGTGGGCTGAGGGTGCAGGCACGTGCTTAC
CAGGTATTCAAACTTCATGGTGGGCTGAGGGTGCAGGCATGTGCTTAC
CGCACACTCAAACTTCATGGGGGGCTGAGGGTGCAGGCATGTGCGTAC
CAGGTATTCAAACTTCATGGTGGGCTGAGGGTGCAGGCATGTGCTTAC
CACGCATTGAAACTTCAGGGCGGGCTGAGGATGCAGGCATGTGCTTAC
CAGGCACTCAAACTTCACGGCAGGCTGAGGGTGCAGGCATGTGCTTAC
CAGGCACTCAAACTTCACGGCAGGCTGAGGGTGCAGGCATGTGCTTAC
CACGCACTCAAACTTCACGGCGGGCTGAGGGTGCAGGCACGAGCTTAC
CACGCATTGAAACTTCAGGGCGGGCTGAGGATGCAGGCATGTGCTTAC
CACACACTCAAACTTCACGACAGGCTGAGGGTGCAGGCATGTGCTTAC
CACGCACTCAAACTTCACGGCGGGCTGAGGGTGCAGGCACGAGCTTAC
CACACACTCAAACTTCACGGCGGGCTGAGGGTGCAGGCACGAGCTTAC
CACACACTCAAACTTCACGACAGGCTGAGGGTGCAGGCATGTGCTTAC

GTCACAGGGCTATGGAACAGGCCAGGGCTGCACGGCTATAGAACAGGCCGGG
GTCACACGGCTATGGAACAGGTTGGGGTTACATGGCTATAGAACAGGCCGGG
GCCACATGGCTATGGAACAGGTTGGGGTTACTTGGCTATAGAACAGGCCGGG
GCCACACGGCTATGGAACAGGTTGGGGTTACGTGGCTCTACGGAACAGGCTG
GGGTTACATGGCTATAGAACAGGCCGGGGCCACACGGCTATGGAACAGGCCG
GGGTTACGTGGCTACGGAACAGGCTGGGGTTACATGGCTATAGAACAGGCCG
GGGCCACAGGGCTATGGAACAGGCTGGGGTTACATGGCTATAGAACAGGCCG
GGGCCACACGGCTATGGAACAGGTTGGGGTTACGTGGCTACGGAACAGGCTG
GGGTTACATGGCTATAGAACAGGCCGGGGCCACAGGGCTATGGAACAGGCTG
GGGTTACATGGCTATAGAACAGGCCGGGGCCACATGGCTATGGAACAGGTTG
GGGTTACTTGGCTATAGAACAGGCCGGGGCCACACGGCTATGGAACAGGCTG
GGGTTACATGGCTATAGAACAGGCCAGGGCCACAGGGCTATGGAACAGGCTG
GGGTTACTTGGCTATAGAACAGGCCGGGGCCGCACGGCTATGGAACAGGTTG
GGGTTACATGGCTATAGAACAGGCCAGGGCCACAGGGCTATGGAACAGGCTG
GGGTTACTTGGCTACAGAACAGGCCAGGGCCACAGGGCTATGGAACAGGCTG
GGGTTACATGGCTATAGAACAGGCCGGGGCCACACGGCTATGGAACAGGCTG
GGGTTACATGGCTATAGAACAGGCCAGGGCCACATGGCTATGGAACAGGTTG
GGGTTACGTGGCTATAGAACAGGCCAGGGCCACACGGCTATGGAACAGGTTG
GGGTTACATGGCTATAGAACAGGCCGGGGCCGCACGGCTATGGAACAGGCTG
GGGTTACATGGCTATAGAACAGGCCAGGGCCACACGGCTATGGAACAGGTTG
GGGTTACGTGGCTATAGAACAGGCCAGGGCCACACGGCTATGGAACAGGCTG
GGGTTACTTGGCTATAGAACAGGCCAGGGCCACAGGGCTATGGAACAGGCTG
GGGTTACTTGGCTACAGAACAGGCCAGGGCCACAGGGCTATGGAACAGGCTG
GGGTTACATGGCTATAGAACAGGCCGGGGCCACACGGCTATGGAACAGGCTG
GGGTTACATGGCTATAGAACAGGCCAGGGCCACATGGCTATGGAACAGGTTG
GGGTTACGTGGCTATAGAACAGGCCAGGGCCACACGGCTATGGAACAGGTTG
GGGTTACATGGCTATAGAACAGGCCGGGGCCGCACGGCTATGGAACAGGCTG
GGGTTACATGGCTATAGAACAGGCCAGGGCCACAGGGCTATGGAACAGGCTG
GGGTTACTTGGCTACAGAACAGGCCAGGGCCACAGGGCTATGGAACAGGCTG
GGGTTACTTGGCTATAGAACAGGCCGGGGCCGCACGGCTATGGAACAGGCTG
GGGTTACTTGGCTATAGAACAGGCCGGGGCCGCACGGCTATGGAACAGGCTG
GGGTTACTTGGCTATAGAACAGGCCGGGGCCACACGGCTATGGAACAGGCTG
GGGTTACATGGCTATAGAACAGGCCGGGGCCACATGGCTATGGAACAGGTTG
GGGTTACGTGGCTATAGAACAGGCCGGGGCCGCAGGGTTATGGACCAGGCTG
GGGTTACATGGCTACAGAACAGGCCAGGGCCCCAGGGTATGGAACAGGCTGG
GGTTACTTGGCTACAGAACAGGCCAGGGCCACACGGCTATGGAACAGGCTGG
GGTTACATGGCTACAGAACAGGCCAGGGCCACAGGGCTATGGAACAGGCTGG
GGTTACTTGGCTACAGAACAGGCCAGGGCCACAGGGCTATGGAACAGGCTGG
GGTTACTTGGCTACAGAACAGGCCAGGGCCACACGGCTATGGAACAGGCTGG
GGTTACATGGCTATAGAACAGGCCAGGGCCACAGGGCTATGGAACAGGCTGG
GGTTACATGGCTACAGAACAGGCCAGGGCCACAGGGCTATGGAACAGGCTGG
GGTTACATGGCTATAGAACAGGCCGGGGCCGCACGGCTATGGAACAGGCTGG
GGTTACATGGCTACAGAACAGGCCAGGGCCACAGGGTATGGAACAGGCTGGG
GTTACTTGGCTACAGAACAGGCCAGGGCCACACGGCTATGGAACAGGCTGGG
GTTACATGGCTACAGAACAGGCCAGGGCCACAGGGTATGGAACAGGCTGGGG
TTACTTGGCTACAGAACAGGCCAGGGCCACACGGCTATGGAACAGGCTGGGG
TTACATGGCTATAGAACAGGCCAGGGCCACAGGGCTATGGAACAGGCTGGGG
TTACATGGCTACAGAACAGGCCAGGGCCACAGGGTATGGAACAGGTCAGTAT

GCAGACCCCACGCCGGTTCCCTCCGCAGACCCCACACCCGTTCCCTCC
GCAGACCCCACACCCGTTCCCTCCGAAGACCCCACACCCGTTCCCTCC
GCAGACCCCACGCCCGTTCCCTCCGCAGACCCCACGCCCGTTCCCTCC
GAAGACCCCACGCCCGTTCCCTCCGCAGACCCCACGCCCGTTCCCTCC
GCAGACCCCACGCCCGTTCCCTCCGCAGACCCCACGCCCGTTCCCTCC
GCAGACCCCACGCCCGTTCCCTCCGAAGACCCCACGCCCGTTCCCTCC
GCAGACCCCACGCCCGTTCCCTCCGCAGACCGCACGCCCGTTCCCTCC
GCAGACCCCACGCCCGTTCCCTCCGCAGACCCCACGCCCGTTCCCTCC
GCAGACCCCACGCCCGTTCCCTCCGAAGACCCCACGCCCGTTCCCTCC
GCAGACCCCACGCCCGTTCCCTCCGCAGACCCCACGCCCGTTCCCTCC
GCAGACCCCACGCCCGTTCCCTCCGCAGACCGCACGCCCGTTCCCTCC
GCAGACCCCACGCCCGTTCCCTCCGCAGACCCCACGCCCGTTCCCTCC
GAAGACCCCACGCCCGTTCCCTCCGAAGACCCCACGCCCGTTCCCTCC
GCAGACCCCACGCCCGTTCCCTCCGCAGACCCCACGCCCGTTCCCTCC
GAAGACCCCACGCCCGTTCCCTCCGCAGACCCCACACCCGTTCCCTCC
GCAGACCCCACACCCGTTCCCTCTGCAGACCCCACACTCATTCTCTCT

ACACCACACACACAACACACACTATACACACACCACACCACACGCGACAC
ATCACACACACCACACATGCCACACACAAGACCACACGCATTACACAACA
CACAACACACACACCACACACCAGACACACACAACACACACGCCACACAT
GCCACACACACCCCACACACAACACACACCACATACATACCACACACCCC
ACACACACACCACACACCAGACACACACCACACACAACACAACACACACA
CCACACACAACACATCACACAACACACACCAGACACACAACACAACACAC
ACCCCACACAACACACAAACTCCACACACTATACACCACACACACAACAC
ACAAAGCACACACCACACACCAGACACACCACACACACAACACACACAAC
ACACAAAGCACACACCACACACCAGTCACACCACACACACACACCACATC
CACCACAGACACACTACACACACCACACCTCACACACACCACATATCAAA
CACACCACACACACACATGCTTCACACCACACACACACCACACACACACC
ATGTATGCACCACACACACACCACACACTATACACACACCACACACACAC
TATGTATGCACCACACACACAATACACACTATACACACACCACACCACAC
ACCTCACACATATCACACATTACACGTGTACAACACAGCCACACATACCT
TTGTGTGCATGCAGATTCTAAACTCTACACACATACATGTACCATACACA
CACTGCACACACCACACACTCACTACACACATACACGCACCACGCACACG
CACACCACGCCACACACACTCTACTCCACACACACATCAGACACATCACA

AGGGGGAATCACGGCACAGGGGGAGTCACGGC
ACGGGGGGAGTCACGGTACGGGGGGAGTCACG
GCACGGGGGGAGTCACGGCACGGGGGGAGTCA
CGGCACGGGGGGAGTCACGGCACGGGGGGGTC
ACGGCACGGGGGAGTCACGGCACGGGGGGAGT
CACGGCACGGGGGGAATCACGGCACGGGGGGA
GTCACGGCACAGGGGGAGTCACGGCCCGGGGG
GGTCACGGCCCGGGGGGAGTCACGGCACAGGG
GGAGTCACGGCACAGGGGGGGTCACGGCACGG
GGGGAGTCACGGCACGGGGGGAGTCACGGCAC
GGGGGGGTCACGGCACGGGGGAGTCACGGCAC
GGGGGGAGTCACGGTACGGGGGGAGTCACGGC
ACGGGGGGAATCACGGCACGGGGGGAGTCACG
GCACAGGGGGAGTCACGGCCCGGGGGGGTCAC
GGCACGGGGGGAGTCACGGCACGGGGGGGTCA
CGGCACGGGGGAGTCACGGCACGGGGGGAGTC
ACGGCACGGGGGGAATCACGGCACGGGGGGAG
TCACGGCACAGGGGGAGTCACGGCCCGGGGGG
GTCACGGCCCGGGGGGAGTCACGGCACGGGGG
GAGTCACGGCACGGGGGGAGTCACGGCACGGG
GGGAGTCACGGCACGGGGGGGTCACGGCACGG
GGGAGTCACGGCACGGGGGGAGTCACGGCACG
GGGGGGGTCACGGCACGGGGGGAGTCACGGCA
CAGGGGGAGTCACGGCCCGGGGGGGTCACGGC
CCGGGGGGGTCACGGCCCGGGGGGAGTCACGG
CACAGGGGGAGTCACGGCACAGGGGGGGTCAC
GGCACGGGGGGGTCACGGCACGGGGGGAGTCA
CGGCACGGGGGGGGTCACGGCACGGGGGGAGT
CACGGCACGGGGGGGGTCACGGCACGGGGGGG
GTCACGGCACGGGGGGAGTCACGGCACGGGGG
GAGTCACGGCACGGGGGAGTCACGGCGCGGGG

TGGTGTTTGATGAGTATCCGCAGGTGCACGGAAACACGGGCCATGGGA
CATTTCCCACGAGTGTTCACAAGGGGAATAAAAACACAGGTTGTGGGG
CATTTCCCACGAGTGTTCACAAGGGGAATAAAAACACAGGTTGTGGGG
CATTTCCCACGAGTGTCTGCAGGCGCACAGAAACACGGGCCGTGGGAC
AGTTCCCACAAGTGTTCACAAGGGGAATAAAAACACAGGCTGTGGGGC
ATTTCCCACAAGTGTCCGCAGGTGCACAGAAACATGGGCCGTGGGACA
TTTCCCACAAGTGTTCACAAGGGGAGTAAAAACACAGGCTGTGGGGCA
TTTCCCACGAGTGTCCGCAGGTGCACAGAAACACGGGCCATGGGACAT
TTCCCACAAGTGTTCACAAGGGGAATAAAAACACAGGCTGTGGGGCAT
TTCCCACAAGTGTCCGCAGGTGCACAGAAACATGGGCCGTGGGACATT
TCCCACAAGTGTTCACAAGGGGAATAAAAACACAGGCTGTGGGGCATT
TCCCACAAGTGTCCGCAGGTGCACAGAAACACGGGCCATGGGACATTT
CCCTTGAGTGTTCACAAGGGGAGTAAAAACACAGGTCATGGGACATTT
CCCTTGAGTGTTCACAGGTGCACAGAGACACGAGCCGTTGGGTGTTTC
CCACGAGTGTTCACAGGTGCACAGAAACACGGGCCATGAGACATTTCC
CACGAGTGTTCACAAGGGGAATAAAAACACAGGCTATGGGGCATTTCC
CACGAGTGTTCACAAGGGGAATAAAAACACAGGCTATGGGGCATTTCC
CACGAGTGTTCACAAGGGGAATAAAAACACAGGCTATGGGGCATTTCC
CACGAGTGTCCGCAGGTGCACAGAAACATGGGCAGT

CTGGGGGCCATTGCGGAGGGAGAGGCCTGGGCACGGATGCTGAAGGCTGCC
CCGGGGGGCATTGCGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCGCC
CCGGGGGGCATTGCGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCGCC
CCGGGGGGCATTGTGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCGCC
CCGGGGGGCATTGTGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCGCC
CCGGGGGGCATTGTGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCGCC
CTGGGGGCCATTGCGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCGCC
CTGGGGGCCATTGTGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCGCC
CCGGGGGGCATTGTGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCGCC
CCGGGGGGCATTGTGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCGCC
CCGGGGGGCATTGTGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCGCC
CCGGGGGGCATTGTGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCGCC
CCGGGGGGCATTGCGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCGCC
CTGGGGGCCATTGTGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCGCC
CCTGGGGGGCATTGTGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCGC
CCCTGGGGGGCATTGCGGAGGCAGAGGCCTGGGCACGGATGCTGAAGGCCG
CCCTGGGGGGCATTGCGGAGGCAGAGGCCTGGG

AAAGGCAGAGAGAAGGGTGATCTAGAAAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAAGGATTTAT
AAGGGCAGAGAGAAGGGTGGTCTGGAAAGGGATTTAT
AAGGACAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
AAGGGCAGAGAGAAGGGTGGTCTGGAGAAGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
AAGGACAGAGAGAAGGGTGGTCTGGAGAAGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
AAGGGCAGAGAGAAGGGTGGTCTGGAGAAGGATTTAT
ATGGGCAGAGAGAAGAGTGGTCTGTAGAGGGATTTAT
AAGGGCAGAGAGAAGGGTGGTCTGGAGAAGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
AAGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
AAGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
AAGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
AAGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
AAGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
AAGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
AAGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
AAGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAAGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
AAGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
AAGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAAGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAAGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAAGGATCTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAAGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAAGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
AAGGACAGAGAGAAGGGTGGTCTGGAAAGTGATTTAC
AAGGGTAGAGAGAAGGGTGCTCTGGAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
AAGGACAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
ATGGGCAGAAAGAAGGGTGGTCTGGAGAAGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAAGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGGAGAGGGATTTAT
AAGGACAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGAGGGATTTAT
ATGGGCAGAGAGAAGGGTGGTCTGTAGGGGAATTTAT

CCTGGTGGCCCCTGACCCCGAGGCCTCTCACCTTGCTCCTTGGTAATAGTGG
GCGCACACTGTCATTGGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAATGG
ACACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGG
ACACCTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGG
ACACCTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGG
ACACATGCTGTCACTCGGGTTCAGGGTATGGAGAGCTCCTTGGTAATAGTGG
ATGCGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGG
ATGTGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGATAATAATGG
ACACGTGCTGTCACTCGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGGA
TGCGTGCTGTCACTCGGGTGCAGGGTGTGGAGAGCTCCTTGATAATAATGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTGTGGAGAGCTCCTTGGTAACAGTGGA
CACGTGCTGTCACTTGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGGA
CACACGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGGA
TGCGTGCTGTCACTCGGGTGCAGGGTGTGGAGAGCTCCTTGATAATAATGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGT
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTGCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTGCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTGCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGATAATAATGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTGCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGT
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTGCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTGCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTGCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTGCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTGCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTGCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTGCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTGCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTGCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAAGAGTGGA
CACATGCTGTCACTCGGGTGCAGGGTATGGAGAGCTGCTTGGTAATAGTGGA
CACGTGCTGTCACTCGGGTGCAGGGTATGGAGAGCTCCTTGGTAATAGTGGA
CGCACGCTGTCACTGGGGCGCAGGGTATGGAGAGCTGGATGCACAGCTTCAT

AGTGAGGTTTAACCCTTACAGTCCTTTGAGAAAGATCGTGTGTACTA
AGTGAGGTTTAACCCTTACAGTCCTTTGAGAAGAATCGTGTGTACTA
AGTGAGGTTTAACCCTTATACTCCTTTGAGGAGGATCGTGTGTACTA
AGTGAGGTTTAACCCTTAGAGTCCTTTGAGGAGGATCGTGTGTACTA
AGTGAGGTTTAACCCTTACAGTCCTTTGAGGAGGATCGTGGGTACTA
AGTGAGGTTTAACCCTTACAGTCCTTTGAGAAGGATCGTGTGTACTA
AGTGAGGTTTTACCCTTACAGTCCTTTGAGGAGGATCGTGTGTACTA
AGTGAGGTTAAACCCTTACAGTACTTTGAGGATAATCATGTATACTA
AGTGAGGTTTAAGCCTTACACTGCTTTGAGAAGGATCGTGTGTACTA
AGGGAGGTTTAACCCTTACAGTCCTTTGAGGAGGATCGTGTGTACTA
AGTGAGGTTTAACCCTTGCAGTCGTTTGAGAAGGATCGTGAGTACTA
AGTGAGGTTTAACCCTTACAGTCCTTTGAGGAGGATCCTGTGTACTA
AGTGAGGTTTAACCCTTATACTCCTTTGAGAAGAATCGTGTGTACTA
ACTGAGGTTTAATCCTCACAGTACTTGGAGGAGGATCATGTATACTA
AGTGAGGTTTAACACTTACAGTTCATTGAGGAGGATTTTGTGTACTA
AGTGAGGTTTAAACCTCACAGTCCTTTGTGAAGGATCGTGTGTACTA
AGTGAGGTGTAACCCTTACAGTCCTTTCAGAAAGATCGTGTGTACTA
AGTGAGGTGTAACCCTTACAGTCCTTTGAGAAAGATCGTGTGTACTA
AGTGAGGTTTTACCCTTACAGTCCTTTGAGGAGAATCATGTGTACTA
AGTGAGGGTTAACCCTTACAGTCCTTTGAGGAGAATCATGTGTACTA
AGTGAGGGTTAACCCTTACAGTCCTTTGAGGAGGATCGTGTGTACTA
AGTGAGGTTTAACCCTTACAGTCCTTTGAGGAGGATCGTGTGTACTA
AGTGAGGTTTAACCCTTGCAGTCGTTTGAGAAGGATAGTGAGTACTA
AGTGAGGTTTAACCCTTATACTCCTTTGAGAAGAATCGTGTGTACTA
ACTGAGGTTTAACCCTCACAGTACTTGGAGGAGGATCATGTATACTA
AGTGAGGTTTAATACTTACATTTCATTGAGGAGGATTTTGTGTACTA
AGTGAGGTTAAACCTTGCAGTCCTTTGTGAAGGATCATGTGTACTAA
GTGAGGTGTAACCCTTACAGTCCTTTGAGAAAGATGGTGTGTACTAA
GTGAGGTTTAACCCTTACAGTCCTTTGAGAAGGATCGTGTGTACTAA
GTGAGGTTTAACCCTTACAGTCCTTTGAGGAGGATCGTGGGTACTAA
GTGAGGTTTAACCCTTACAGTCCTTTGAGAAGGATCGTGTGTACTGA
GGATTAACCTTTACAGTCCTTTCAGAAGGATGGTGTGTACTAAGTGA
GGTTTAACCCTTACAGTCCTTTGAGAAGGATCGTGTGTACTAAGTGA
GGTTTAACCCTTACAGTCCTTTGAGAAGGATCGTGTGTATTAAGTGA
GGTTTAACCCTTACAGTGTTTTGAAAAGGATCGTGTGTACTAAGGTT
TAACCACTATAGTCCTTTTATGAGAACCATGTGTACTAAGTGAGGTT
TAACCCATACAGTCCTTTGAGAAGGGTCGTGTGTACTAACTGAGGTT
TAACCCTTACAGTCCTTTGACGAGGATTGTGTGTACTGAGGTTTAAC
CCTTACAGTCCTTTGAGGAGGATCGTGTGTACTAAGTGAGGTTTAAC
CCTTACAGTACTTTGAGGAGGATCGTGTGTACTAAGTGAGGTTTAAC
CCTTACAGTCCTTTGAGGAGGATCATGTGTACTAAGTGAGGTTTAAC
CCTTACAGTCCTTTGAGGAGGATCATGGGTACTGAGGATTAACCCTT
ATAGTCCTTTGAGAAGAATGGTGTGTACTAAGTGAAATTTAACACTT
ACAGTCCTGTGAGGAGAATCGTGTGTACTAAGTGAGGTTTAACCCTT
ACAGTCCTTTGAGAAGGATCGTGTGTACTAAGTGAGGATTAACCCTT
ACAGTCCTTTCAGAGGGATGGTGTGTACTAAGTGAGGTTTAACCCTT
ACAGTCCTTTGAGGAGGATCGTGTTTCCTAAGTGAAGTTTAACCCTT
ACAGTCCTTTGAGGAGGGTGGTGTGTACTAAGTGAGGTTTAACTCTT
ACAGTCCTTTGAGGAGGATCGTGTGTACTAAGTGAGGTTTAACCCTT
ACAGTCCTTTGAGGAGAATCATGTGTACTAAGTGAGGGTTAACCCTT
ACAGTCCTTTGAGGAGGATCGTGTGTACTAAGTGAGGTTTAACCCTT
ACGGTCCTTTGAGGAGGATCGTGTGTAACTAAGTGAGGTTTAACCCT
TACGGTCCTTTGAGGAGGATCTTGTGTACTAAGTGAGGTTTAACCCT
TACAGTCCTTTGAGGAGGATCGTGTGTACTAAGTGAGGTTTAAACCT
TACAGTCCTTTGAGAAGGATCGTGTGTACTAACTGAGGTTCAACACT
TACAGTCCTTTGAGGAGGATCCTGTGTGCTAAGTGAGGTTTAAACCT
TACACTCCTTTGAGGAGAATCATGTGTACTAAGTGAGGTTTAACCCT
TACAGTCCTTTAAGGAGGATCTTTTGAACTAAGTGAGGTTTAACCCT
TACAGTCCTTTGAGGAGAATCATGTGTACTAAGTGAGGTTTCACCCT
TACAGTCCTTTGAGAAGGATCTTCTCTACTAAGTGAGGTTTAACCCT
TAGAGTCCTTTGAGGAGGATCGTGTGTAGTAAGTGAGGTTTAACCCT
TACAGTCCTTTGAGAAGGATCTTCTGTACTAAGTGAGGTTTAACCCT
TACAGTCCTTTGAGAAGGATCGTGTGTACTCATGTTTAACCCCTATA
GTCCTTTGAGGAGAATTGTGTGTACTAAGTGAAGTTTAACCCTTATA
CTCCTTTGAGAAGGATCGTGTGTACTAAGGGAAGTTTAACCCTTATA
GTCCTTTGAGGAGGATTGTGTGTACTAAGTAAGGTTTAACCCTTATA
GTCCTTTGAGAAAAATGGTGTGTACTAAGTGTGGTTTAACCCTTACA
GTCCTTTGAGGAGGGTCTTGTGTACTACGTGAGGTTTAACCCTTACA
GTCCTTTGAGAAGGATCGTGTGTATTAAGTGAGGTTTAATCCTTACA
GTCCTTTGAGGAGGATCGTGTGTACTAAGTGAGGTTTAACGCTTACA
GTCCTTTGAGAAGGATCGTGTGTACTAAGTGGGGTTTAACCCTTACA
GTCCTTTGAGGAGGATCTTGTGTACTAAATCAGGTTTAACCCTTACA
GTCGTTTGAGGAGGATCGTGTGTGCCAAGTGAGGTTTAACCCTTACA
GTCCTTTGAGAAGGATCGTGTGTACTAATGTTTAACCCCTATAGTTC
TTTGAGGAGAATTTCGTGTACTGAGGTTTAACCCTTACAGTCCTTTG
AGGAGGATCGTGTGTACTAAGTGAGTTTTAACCCTTACAGTCCTTGG
AGGAGGATCATGTGTAGTAAGTGAGGTTTAACCCTTACAGTCCTTTG
AGAAGGATTGTGTGTACTAAGGTTTAACCCCTATAGTCCTTTTAGGA
GAATTGTGTTTACTAAGTGAGGTTTTACCCTTACAGTCCTTTGAGGA
GGATCGTGTGTACTAAGTGAGGTTTAACCCTTACAGTCCTTTGAGGA
GGATCATGTGTACTAAGTGAGGTTTAATCCTTACAGTCCTTTGAGAA
GAATCTTGTGTACTAAGTGAGGTTTGTCCCTTACTGTCCTTTGAGAA
GAATCGTATGTACTAAGTGAGGTTTAACCCTTACAGTCCTTTGAGGA
GGATCGTGTGTACTAAGTGAGGTTTAACATTTACAGTCCTTTGAGAA
GGATCGTGTGTACTAAGTGATGTTTAAGCCTCAGAGTCCTTTGAGAA
GGATCGTGTGTACTAAGTGATGTTTAACCCTTACAGTCCTTTGAGGA

GGGGGTGCTCTGGTGTGTGGGTGCTCTGGTGT
GTGGGTGCTTCGGTGTATGGGTGCCCTGGTGT
GTGTGTGGTCTGGTGTGTGGGTGCTCCAGTGT
ATGAGTGCCCTGGTGTGTGGGTGCTCTGGTAT
GTGGGTGCCCTGGTGTACGGGTGCCCCGGTGT
TCGGGTGCCCTGGTGTGTGGGTGCTCTGGTGT
GTGGGTGCTCCAGTGTATGAGTGCCCTGGTGT
GTGGGTGCTCTGGCATGGGGGTGCTCTGGTGT
GTGGGTGCTCTGGTGTATGGGTGCCCTGGTGT
GTGCGTGCCCTGGTGTATGGGTGCCGTGGTGT
GTCAGTGCCCTGGTGTGTGGGTGCTCTGGTGT
GTGGGTGCCCTGGTTTACGGGTTTCCTGGTCT
GTGGGTGCCCTGGTGTATGGGTGCCCTGGTGT
GTGGGTGCTCTGGTGTACGGGTGCCCTGGTGT
ACGGGTGCCCTAGTGTGTGGGTGCTCTGGTGT
GTGGGTGCCCTGGCGTGTGGGTGCCCTGGCGT
GTGGGTGCCTGGCGTGTGGGTGCTCTGGCATG
TGGGTGCTCTGGTGTACGAGTGCCCTGGTGTG
TGGGTGCTCTGGTGTGTGAGTGCCCTGGTGTG
TGGGTGCTCTGGTGTGTGGGTGCCCCAATATG
TGGGTGCCCCGGTGTACAGGTGCCCCGGTGTA
CGGGTGCTCTTGTGTGTAGGTGCTCTGGTGCG
TGGGTGCTTTGCTGTATGGATGC

TCTGTCTCTGAGTCTGTCTCTGCCTCTGCCTCTCTCTGTCTCTCAGAGGT
CTGTCTCTGTCTCTGCCTCTCTCTGTCTCTCTGTCCCTCTCTGTCTCTGT
CTCTCCCTGTCTCTGTCTCTCTGTTGCTGTCTCTGCCTCTGTCTCTGCCT
CTCTCTGTGTCTCTCTGCCCCTCCCTCTGTCTCTGTCCCTCTCAGTCTCT
GGTTTTGTCTCTGTCTCTCTCTGTCTCTGCCTCTGCCTCTCTCTGTCTCT
GTCTCTCTGTCTCTGTCTCTCTCTGTCTCTCTCTGTCTCTTTGTCCCTCT
CTGTCTCTCTCTGTCTCTGTCTCTAGCTCTGCCTCTGTTAGTCCCTCTCT
GTCTCTCCCTGTCTCTGTCTGTCACTGTCTCTGCCTCTGTCTCTGCCTCT
CTGTGTCTCTCTGCCCCTCCCTCTGTCTCTCTCTGTCCCTCTCAGTCTCT
GGTTTTGTCTCTGTCTCTCTCTGTCTCTGCCTCTGCCTCTCTCTGTCTCT
GCCTCTGCCTCTCTCTGTCTCTCTGTCTCTGTCTCTGTCTCTCTCTGTCT
CTGCCTCTGTCTCTCTCTTTGTCCCTCTCTGTCTCTGTCTCTCTCTGTCT
CTGTCTCTAGCTCTGCCTCTGTTAGTCCCTCTCTGTCTCTCCCTGTCTCT
GTCTCTCTGTCGCTGTCTCTGCCTCTGTCTCTGTCTCTCTCCGTCTCTCT
CTGTCTCTCTCTGTCTCTGTCTCTCTCTG
[Ответ][Цитата]
 Стр.44 (140)1  ...  40  41  42  43  [44]  45  46  47  48  ...  140<< < Пред. | След. > >>